Query (optional)   in Class  

GrainGenes Probe Report: GPW7207

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7207
General Remarks
Motif (CGCCG)6
Type
PCR
SSR
PCR primers
Forward CTTGCGGTTGAGGAGGTT
Forward CTTGCGGTTGAGGAGGTT
Reverse GTGCATTCGACCTTGATCTC
Reverse GTGCATTCGACCTTGATCTC
SSR size
Expected 207
Amplification Conditions
Tm = 60C
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09