Query (optional)   in Class  

GrainGenes Probe Report: GPW7215

Probe
GPW7215
General Remarks
Motif (CTG)7
Type
PCR
SSR
PCR primers
Forward TTGACTGCCTAGCTGCCTCT
Forward TTGACTGCCTAGCTGCCTCT
Reverse GGGCAGGAGAAATAGATGGA
Reverse GGGCAGGAGAAATAGATGGA
SSR size
Expected 143
Amplification Conditions
Tm = 60C
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09