Query (optional)   in Class  

GrainGenes Probe Report: GPW7218

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7218  [ Marker Report ]
Locus
Xgpw7218-5A
gpw7218
gpw7218-5A
General Remarks
Motif (AT)7
Type
PCR
SSR
PCR primers
Forward CTAACTGTGATTGCTCCGCA
Forward CTAACTGTGATTGCTCCGCA
Reverse CGGCATTCCTTTTATTTACTCG
Reverse CGGCATTCCTTTTATTTACTCG
SSR size
Expected 147
Amplification Conditions
Tm = 60C
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09