Query (optional)   in Class  

GrainGenes Probe Report: GPW7219

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7219  [ Marker Report ]
Locus
Xgpw7219-3A
General Remarks
Motif (AGG)7
Type
PCR
SSR
PCR primers
Forward CCAAGAGGAAGCCCAAGAG
Forward CCAAGAGGAAGCCCAAGAG
Reverse CCACGGTGTGAGTAGTCGTC
Reverse CCACGGTGTGAGTAGTCGTC
SSR size
Expected 135
Amplification Conditions
Tm = 60C
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09