Query (optional)   in Class  

GrainGenes Probe Report: GPW7220

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7220  [ Marker Report ]
Locus
Xgpw7220-3B
gpw7220
General Remarks
Motif (AG)7
Type
PCR
SSR
PCR primers
Forward TGGGCTCAATAGGGAAAGAA
Forward TGGGCTCAATAGGGAAAGAA
Reverse ATTTAGGCAGCGAAGCAAAA
Reverse ATTTAGGCAGCGAAGCAAAA
SSR size
Expected 133
Amplification Conditions
Tm = 60C
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09