Query (optional)   in Class  

GrainGenes Probe Report: GPW7222

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7222
General Remarks
Motif (GCG)9
Type
PCR
SSR
PCR primers
Forward CTCACTTCCTCCTCCTGCC
Forward CTCACTTCCTCCTCCTGCC
Reverse GTAGCTGTTGATCCAGTTGTCG
Reverse GTAGCTGTTGATCCAGTTGTCG
SSR size
Expected 139
Amplification Conditions
Tm = 60C
Linkage Group
6A/6B/6D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09