Query (optional)   in Class  

GrainGenes Probe Report: GPW7225

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7225  [ Marker Report ]
Locus
Xgpw7225-2A
General Remarks
Motif (GGAC)7
Type
PCR
SSR
PCR primers
Forward ACACCGCAGAGAACAGGC
Forward ACACCGCAGAGAACAGGC
Reverse CACGACCTCGACGACTACCT
Reverse CACGACCTCGACGACTACCT
SSR size
Expected 146
Amplification Conditions
Tm = 60C
Linkage Group
2A/2AL/2B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09