Query (optional)   in Class  

GrainGenes Probe Report: GPW7226

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7226  [ Marker Report ]
Locus
Xgpw7226-2A
General Remarks
Motif (TCCG)3(TCCA)4
Type
PCR
SSR
PCR primers
Forward CACGACCTCGACGACTACCT
Forward CACGACCTCGACGACTACCT
Reverse CAACAGGCAACAACGACAGT
Reverse CAACAGGCAACAACGACAGT
SSR size
Expected 131
Amplification Conditions
Tm = 60C
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09