Query (optional)   in Class  

GrainGenes Probe Report: GPW7229

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7229
General Remarks
Motif (AGCAG)4(GCG)4
Type
PCR
SSR
PCR primers
Forward CAGAAGTCGCAGACCACTCC
Forward CAGAAGTCGCAGACCACTCC
Reverse CGACCGCAGGTTCATCAC
Reverse CGACCGCAGGTTCATCAC
SSR size
Expected 224
Amplification Conditions
Tm = 60C
Linkage Group
7B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09