Query (optional)   in Class  

GrainGenes Probe Report: GPW7238

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7238  [ Marker Report ]
Locus
Xgpw7238-5D
General Remarks
Motif (CA)13
Type
PCR
SSR
PCR primers
Forward CGATCACATCTCGATTTCTCC
Forward CGATCACATCTCGATTTCTCC
Reverse GCTCTGCGCTGCTAATTTTC
Reverse GCTCTGCGCTGCTAATTTTC
SSR size
Expected 124
Amplification Conditions
Tm = 60C
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09