Query (optional)   in Class  

GrainGenes Probe Report: GPW7239

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7239
General Remarks
Motif (CAC)6(ACC)4
Type
PCR
SSR
PCR primers
Forward CATCAAGCAGGAGCTGTTCA
Forward CATCAAGCAGGAGCTGTTCA
Reverse TGGTGGTGGTCATGGACTC
Reverse TGGTGGTGGTCATGGACTC
SSR size
Expected 100
Amplification Conditions
Tm = 60C
Linkage Group
7A/7B/7D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09