Query (optional)   in Class  

GrainGenes Probe Report: GPW7244

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7244  [ Marker Report ]
Locus
Xgpw7244-5B
Xgpw7244-5D
General Remarks
Motif (CAG)13
Type
PCR
SSR
PCR primers
Forward CGCCTCATAGGAATGCTGTT
Forward CGCCTCATAGGAATGCTGTT
Reverse TGCTGTTGCAGTTGCTGTAGT
Reverse TGCTGTTGCAGTTGCTGTAGT
SSR size
Expected 167
Amplification Conditions
Tm = 60C
Linkage Group
5D/5B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09