Query (optional)   in Class  

GrainGenes Probe Report: GPW7246

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7246
General Remarks
Motif (CAG)4
Type
PCR
SSR
PCR primers
Forward CTTTCCAAGGCACTCACCAT
Forward CTTTCCAAGGCACTCACCAT
Reverse CAGCTTTGAGCTTGGCCTT
Reverse CAGCTTTGAGCTTGGCCTT
SSR size
Expected 127
Amplification Conditions
Tm = 60C
Linkage Group
4A (1A/2A/5A)
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09