Query (optional)   in Class  

GrainGenes Probe Report: GPW7250

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7250  [ Marker Report ]
Locus
Xgpw7250-7B
General Remarks
Motif (TAC)9
Type
PCR
SSR
PCR primers
Forward GTACCACCGTGTGTGCTCC
Forward GTACCACCGTGTGTGCTCC
Reverse GACAGCCCAGAACTACTCGC
Reverse GACAGCCCAGAACTACTCGC
SSR size
Expected 168
Amplification Conditions
Tm = 60C
Linkage Group
7B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09