Query (optional)   in Class  

GrainGenes Probe Report: GPW7253

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7253  [ Marker Report ]
Locus
Xgpw7253-4A
General Remarks
Motif (CTAG)3(AGAGA)5(AGCA)3
Type
PCR
SSR
PCR primers
Forward CGTCATCTACGGCTGATCCA
Forward CGTCATCTACGGCTGATCCA
Reverse AACATCTCTGCCTGCATGCT
Reverse AACATCTCTGCCTGCATGCT
SSR size
Expected 162
Amplification Conditions
Tm = 60C
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09