Query (optional)   in Class  

GrainGenes Probe Report: GPW7255

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7255
General Remarks
Motif (TCT)9
Type
PCR
SSR
PCR primers
Forward GCTCGTGTGGAACTTGCC
Forward GCTCGTGTGGAACTTGCC
Reverse TCAATTCATCATCATCGCAA
Reverse TCAATTCATCATCATCGCAA
SSR size
Expected 165
Amplification Conditions
Tm = 60C
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09