Query (optional)   in Class  

GrainGenes Probe Report: GPW7258

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7258  [ Marker Report ]
Locus
Xgpw7258-1A
gpw7258
gpw7258-3B
General Remarks
Motif (TCT)6
Type
PCR
SSR
PCR primers
Forward TCCCAGAACTTCGATGACG
Forward TCCCAGAACTTCGATGACG
Reverse GGTGAGGACGCTTCAAACTC
Reverse GGTGAGGACGCTTCAAACTC
SSR size
Expected 144
Amplification Conditions
Tm = 60C
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09