Query (optional)   in Class  

GrainGenes Probe Report: GPW7259

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7259  [ Marker Report ]
Locus
Xgpw7259-4A
General Remarks
Motif (CGG)4(CGG)5(GGA)4
Type
PCR
SSR
PCR primers
Forward CATCATCGCCGACTGGAC
Forward CATCATCGCCGACTGGAC
Reverse ACTAACCATCTCGTGGTACGC
Reverse ACTAACCATCTCGTGGTACGC
SSR size
Expected 150
Amplification Conditions
Tm = 60C
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09