Query (optional)   in Class  

GrainGenes Probe Report: GPW7262

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7262  [ Marker Report ]
Locus
Xgpw7262-6B
General Remarks
Motif (GC)8(CA)8
Type
PCR
SSR
PCR primers
Forward GCTGCAACCCAAGATGAGAT
Forward GCTGCAACCCAAGATGAGAT
Reverse GCAGTGGCTCGGCTAAAG
Reverse GCAGTGGCTCGGCTAAAG
SSR size
Expected 203
Amplification Conditions
Tm = 60C
Linkage Group
6B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09