Query (optional)   in Class  

GrainGenes Probe Report: GPW7265

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7265
General Remarks
Motif (TTGTG)4
Type
PCR
SSR
PCR primers
Forward ATGATGATGCACGCAATGTT
Forward ATGATGATGCACGCAATGTT
Reverse CAGTAGGTTTCCCTGGTGGA
Reverse CAGTAGGTTTCCCTGGTGGA
SSR size
Expected 208
Amplification Conditions
Tm = 60C
Linkage Group
7A/7D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09