Query (optional)   in Class  

GrainGenes Probe Report: GPW7283

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7283
General Remarks
Motif (CT)17
Type
PCR
SSR
PCR primers
Forward TCTTCTTCTACCTTGAGCTGCC
Forward TCTTCTTCTACCTTGAGCTGCC
Reverse GGGTTAGTAGTCGGTTTTTCCC
Reverse GGGTTAGTAGTCGGTTTTTCCC
SSR size
Expected 113
Amplification Conditions
Tm = 60C
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09