Query (optional)   in Class  

GrainGenes Probe Report: GPW7285

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7285  [ Marker Report ]
Locus
Xgpw7285-2D
General Remarks
Motif (GA)7
Type
PCR
SSR
PCR primers
Forward TATACCAGTACGGAGCTGAACG
Forward TATACCAGTACGGAGCTGAACG
Reverse CTGCTCTGGACCGCAACT
Reverse CTGCTCTGGACCGCAACT
SSR size
Expected 292
Amplification Conditions
Tm = 60C
Linkage Group
2D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09