Query (optional)   in Class  

GrainGenes Probe Report: GPW7287

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7287
General Remarks
Motif (AATA)6
Type
PCR
SSR
PCR primers
Forward GCGGACTCCATAGACGACG
Forward GCGGACTCCATAGACGACG
Reverse TGATCCATTCGGAGAAGCTTA
Reverse TGATCCATTCGGAGAAGCTTA
SSR size
Expected 119
Amplification Conditions
Tm = 60C
Linkage Group
(homoeologous group 4)
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09