Query (optional)   in Class  

GrainGenes Probe Report: GPW7292

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7292  [ Marker Report ]
Locus
Xgpw7292-6B
Xgpw7292-6D
General Remarks
Motif (CTC)7
Type
PCR
SSR
PCR primers
Forward TGCAAGGAGACCGACTTATCAC
Forward TGCAAGGAGACCGACTTATCAC
Reverse CTTACCTGCTACGAGCGCTG
Reverse CTTACCTGCTACGAGCGCTG
SSR size
Expected 384
Amplification Conditions
Tm = 60C
Linkage Group
6B/6D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09