Query (optional)   in Class  

GrainGenes Probe Report: GPW7293

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7293
General Remarks
Motif (CCGT)3
Type
PCR
SSR
PCR primers
Forward CACCTGCTGGTACACGACTT
Forward CACCTGCTGGTACACGACTT
Reverse GCGGTTACTATCCTGGCAT
Reverse GCGGTTACTATCCTGGCAT
SSR size
Expected 130
Amplification Conditions
Tm = 60C
Linkage Group
2AL
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09