Query (optional)   in Class  

GrainGenes Probe Report: GPW7330

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7330
General Remarks
Motif (GCT)7
Type
PCR
SSR
PCR primers
Forward CCGCCGCTGCTGTAAGAT
Forward CCGCCGCTGCTGTAAGAT
Reverse ACTTGAACGACCCGAACTTG
Reverse ACTTGAACGACCCGAACTTG
SSR size
Expected 133
Amplification Conditions
Tm = 60C
Linkage Group
6A/6D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09