Query (optional)   in Class  

GrainGenes Probe Report: GPW7331

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7331  [ Marker Report ]
Locus
Xgpw7331-2D
General Remarks
Motif (TGC)6
Type
PCR
SSR
PCR primers
Forward CAGCCTCAACGACCACAAC
Forward CAGCCTCAACGACCACAAC
Reverse GGAGAAGACGTTCCTGACCA
Reverse GGAGAAGACGTTCCTGACCA
SSR size
Expected 325
Amplification Conditions
Tm = 60C
Linkage Group
2D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09