Query (optional)   in Class  

GrainGenes Probe Report: GPW7335

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7335  [ Marker Report ]
Locus
Xgpw7335-3B
gpw7335
General Remarks
Motif (GCC)4(GCC)4
Type
PCR
SSR
PCR primers
Forward CCATCGCTACCAACCACC
Forward CCATCGCTACCAACCACC
Reverse CGAGCATGAGCACAATGAAT
Reverse CGAGCATGAGCACAATGAAT
SSR size
Expected 250
Amplification Conditions
Tm = 60C
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09