Query (optional)   in Class  

GrainGenes Probe Report: GPW7337

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7337
General Remarks
Motif (AGCCAG)15
Type
PCR
SSR
PCR primers
Forward GATGAAGCCCGAGCCTAAG
Forward GATGAAGCCCGAGCCTAAG
Reverse GTCTTTATGGGCTCAGTTTTGG
Reverse GTCTTTATGGGCTCAGTTTTGG
SSR size
Expected 282
Amplification Conditions
Tm = 60C
Linkage Group
2D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09