Query (optional)   in Class  

GrainGenes Probe Report: GPW7338

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7338
General Remarks
Motif (TCT)7
Type
PCR
SSR
PCR primers
Forward CGGCTCTGAGATATTATTGACC
Forward CGGCTCTGAGATATTATTGACC
Reverse TGACATGAGCGATGCTGAG
Reverse TGACATGAGCGATGCTGAG
SSR size
Expected 106
Amplification Conditions
Tm = 60C
Linkage Group
1B/1D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09