Query (optional)   in Class  

GrainGenes Probe Report: GPW7339

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7339  [ Marker Report ]
Locus
Xgpw7339-7A
General Remarks
Motif (CGC)9(CGG)4
Type
PCR
SSR
PCR primers
Forward CAGGAAAAAAAGACTCCACCG
Forward CAGGAAAAAAAGACTCCACCG
Reverse ATATCTTGAGGAGCTTCGGC
Reverse ATATCTTGAGGAGCTTCGGC
SSR size
Expected 229
Amplification Conditions
Tm = 60C
Linkage Group
7A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09