Query (optional)   in Class  

GrainGenes Probe Report: GPW7342

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7342  [ Marker Report ]
Locus
Xgpw7342-7B
gpw7342
General Remarks
Motif (GA)43
Type
PCR
SSR
PCR primers
Forward GCGGTGGCAACAACCTAC
Forward GCGGTGGCAACAACCTAC
Reverse GTGCATAAAGAGGGCAGAGC
Reverse GTGCATAAAGAGGGCAGAGC
SSR size
Expected 220
Amplification Conditions
Tm = 60C
Linkage Group
7B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09