Query (optional)   in Class  

GrainGenes Probe Report: GPW7354

Probe
GPW7354
General Remarks
Motif (CGC)10
Type
PCR
SSR
PCR primers
Forward GCACCGTGAACGACTTGAC
Forward GCACCGTGAACGACTTGAC
Reverse GCAAGCACAAGGAGAAGGAC
Reverse GCAAGCACAAGGAGAAGGAC
SSR size
Expected 144
Amplification Conditions
Tm = 60C
Linkage Group
1A/1D (6A)
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09