Query (optional)   in Class  

GrainGenes Probe Report: GPW7364

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7364
General Remarks
Motif (CCA)6
Type
PCR
SSR
PCR primers
Forward CAATGCCAAGAACCGTGTC
Forward CAATGCCAAGAACCGTGTC
Reverse GAAGAATGTCTCCTTCACCCC
Reverse GAAGAATGTCTCCTTCACCCC
SSR size
Expected 188
Amplification Conditions
Tm = 60C
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09