Query (optional)   in Class  

GrainGenes Probe Report: GPW7369

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7369
General Remarks
Motif (GCG)5
Type
PCR
SSR
PCR primers
Forward TGCTGAGACTTGAGACGGG
Forward TGCTGAGACTTGAGACGGG
Reverse GACCATGAAGAGGAAGATCACC
Reverse GACCATGAAGAGGAAGATCACC
SSR size
Expected 143
Amplification Conditions
Tm = 60C
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09