Query (optional)   in Class  

GrainGenes Probe Report: GPW7379

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7379  [ Marker Report ]
Locus
Xgpw7379-2A.1
Xgpw7379-2A.2
Xgpw7379-2D
General Remarks
Motif (CGAG)4
Type
PCR
SSR
PCR primers
Forward CAGCGGAAACCGATTAAAAA
Forward CAGCGGAAACCGATTAAAAA
Reverse ATGTTACTTGGGCTTGGACG
Reverse ATGTTACTTGGGCTTGGACG
SSR size
Expected 183
Amplification Conditions
Tm = 60C
Linkage Group
2A/2D/2A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09