Query (optional)   in Class  

GrainGenes Probe Report: GPW7390

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7390  [ Marker Report ]
Locus
Xgpw7390-4B
General Remarks
Motif (TA)9(TTG)6
Type
PCR
SSR
PCR primers
Forward AAGACGCTCACTCTAGCCGC
Forward AAGACGCTCACTCTAGCCGC
Reverse CGGTCATCGGAATTTCAACT
Reverse CGGTCATCGGAATTTCAACT
SSR size
Expected 131
Amplification Conditions
Tm = 60C
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09