Query (optional)   in Class  

GrainGenes Probe Report: GPW7391

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7391
General Remarks
Motif (GAC)6(ACA)4
Type
PCR
SSR
PCR primers
Forward GCCATATCGTCCACAGGC
Forward GCCATATCGTCCACAGGC
Reverse TTGAGGCGACTGACTGATTG
Reverse TTGAGGCGACTGACTGATTG
SSR size
Expected 135
Amplification Conditions
Tm = 60C
Linkage Group
(2AS) 2D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09