Query (optional)   in Class  

GrainGenes Probe Report: GPW7399

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7399  [ Marker Report ]
Locus
Xgpw7399-2A
General Remarks
Motif (GTT)5
Type
PCR
SSR
PCR primers
Forward TACATCTCTTCATCTCATCGGC
Forward TACATCTCTTCATCTCATCGGC
Reverse CAGCAACAATTCCCCCAG
Reverse CAGCAACAATTCCCCCAG
SSR size
Expected 178
Amplification Conditions
Tm = 60C
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09