Query (optional)   in Class  

GrainGenes Probe Report: GPW8004

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW8004  [ Marker Report ]
Locus
Xgpw8004-2D
General Remarks
Motif (AT)10
Type
PCR
SSR
PCR primers
Forward GGTCAATCTTGCTGGTCGAT
Reverse TCTTGTTCCAAAGCCAAAGG
SSR size
Expected 192
Amplification Conditions
Tm = 60C
Linkage Group
2D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09