Query (optional)   in Class  

GrainGenes Probe Report: GPW8188

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW8188  [ Marker Report ]
Locus
Xgpw8188-7D
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (GAC)5
Type
PCR
SSR
PCR primers
Forward CATGGTCAACGTCTGGGTG
Forward CATGGTCAACGTCTGGGTG
Reverse CTTGGAGAGTAGGACGGCAG
Reverse CTTGGAGAGTAGGACGGCAG
SSR size
Expected 180
Amplification Conditions
Tm = 60C
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09