Query (optional)   in Class  

GrainGenes Probe Report: GPW8261

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW8261  [ Marker Report ]
Locus
Xgpw8261-5A
General Remarks
Motif (AAG)6
Type
PCR
SSR
PCR primers
Forward TTATCTCTCCAGGGTGGCTG
Forward TTATCTCTCCAGGGTGGCTG
Reverse AGTTCAGGATTACAGGCGACA
Reverse AGTTCAGGATTACAGGCGACA
SSR size
Expected 248
Amplification Conditions
Tm = 60C
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09