Query (optional)   in Class  

GrainGenes Probe Report: GPW94002

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94002
General Remarks
Motif (TC)19.5
Type
PCR
SSR
PCR primers
Forward CTTCCGATGAAGCGTGAGTA
Reverse TCCAAGAACATCAAGGAGAACA
SSR size
142
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre