Query (optional)   in Class  

GrainGenes Probe Report: GPW94008

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94008
General Remarks
Motif (GA)10, (TG)18
Type
PCR
SSR
PCR primers
Forward AAGAGCTCCTGCGAGAGAGA
Reverse GTCCCTCCAGGTCGCAG
SSR size
122
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre