Query (optional)   in Class  

GrainGenes Probe Report: GPW94010

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94010
General Remarks
Motif (TAAA)3
Type
PCR
SSR
PCR primers
Forward TTGAGGGGTAAAAAATGGCA
Reverse GCGCCCTGTGTTGTTTATCT
SSR size
349
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre