Query (optional)   in Class  

GrainGenes Probe Report: GPW94018

Probe
GPW94018
General Remarks
Motif (TC)13
Type
PCR
SSR
PCR primers
Forward CGTCGTAGGAGGCGTAGC
Reverse ACACTCCACTCTAGCCACAGC
SSR size
126
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre