Query (optional)   in Class  

GrainGenes Probe Report: GPW94021

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94021
Locus
gpw94021
General Remarks
Motif (GT)12, (GA)16
Type
PCR
SSR
PCR primers
Forward CCATTGGAGGCGAATACAAC
Reverse ATCACAGAAAATGCCACCG
SSR size
145
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre