Query (optional)   in Class  

GrainGenes Probe Report: GPW94025

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94025
General Remarks
Motif (TG)20
Type
PCR
SSR
PCR primers
Forward GGCATTCCGTCAAGCAGGTT
Reverse TCCCGTGGAGGCAAAACA
SSR size
161
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre