Query (optional)   in Class  

GrainGenes Probe Report: GPW94027

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94027
Locus
gpw94027
General Remarks
Motif (CT)38
Type
PCR
SSR
PCR primers
Forward GCCCCAGACTTACACGTCAT
Reverse CACCGATGGTTCAACGAAG
SSR size
174
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre