Query (optional)   in Class  

GrainGenes Probe Report: GPW94029

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94029
General Remarks
Motif (TC)17
Type
PCR
SSR
PCR primers
Forward CGGGTAGGTTAGGTGGGC
Reverse GCAATGGCCTAAGTTAAAATGG
SSR size
181
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre